Among the trades the aliens offer a reasonable amount of some other commodity in exchange for the mineral rights to a 1 km x 1 km stretch of land out in a desert somewhere. The land has a few trace amounts of minerals with some value, but nothing humans have the technology to extract in a profitable way at the moment. Agreements are signed and the aliens get the mineral rights.

The aliens create a cylindrical force field about a kilometer in diameter and start extracting the entire volume of earth as one huge core which is slowly and constantly streamed up through the atmosphere to where a giant mothership waits in geosynchronous orbit to collect it. The mothership never seems to increase in size or actually store this tremendous volume of rock anywhere so it’s speculated that there must be a wormhole on board which is transporting the rock elsewhere for processing.

As time goes by it becomes obvious that the aliens aren’t going to be satisfied with the first couple miles or so of rock. Eventually molten hot magma begins flowing up through the forcefield for days on end. It’s soon clear that the aliens are extracting everything all the way down to the very center of the Earth. It’s realized that this will geologically destabilize the region as a sort of super-volcano will probably form in the area once the core is removed and the forcefield is collapsed.

World governments are notified and negotiations with the aliens are started. Unfortunately negotiations with the aliens fail. The contract they signed was very specific and they aren’t going to let the humans out of it.

But things could be worse. The region being destabilized is pretty far from most civilization and shouldn’t have too huge an impact on human culture.

However things are worse. Several weeks later scientists calculate that the volume of rock and magma extracted has exceeded the volume of a cylinder stretching to the Earth’s center. Apparently the aliens are relying on the pressure at those tremendous depths to push the surrounding magma into the cylinder. In essence it’s like they’ve poked a drinking straw into the center of a water-balloon (without popping the balloon) and are relying on the pressure inside the balloon to push the liquid up through the straw. In a few years the Earth will be racked with massive ‘quakes as it’s entire geology destabilizes from the center outward.

Attempts to use military power fail as human nuclear missiles and other stratagems have no effect on the force field or the ship waiting in space.

To make matters worse, by sucking right from the center the aliens are depleting the nickle-iron core material first. With this material being siphoned off the Earth’s magnetic field is failing, allowing some of the harder forms of cosmic radiation to stream in. Things get increasingly worse as cancer rates rise and earthquakes rock the globe more and more frequently. Gradually, over the space of many years, tides get higher due to the Earth:moon gravitational pull being lower than it was in times past. In time the atmosphere begins to thin out as well, since there’s not so much mass to hold it in place any more

Humanity meets a slow and miserable end as their world crumples over the decades like a raisin.

In his final hours the last human survivor ruminates on why the aliens would do this to Earth when there are plenty of other planets in the solar system, not to mention asteroids, which could be mined without killing off the local populace. He (the last human is almost always male for some reason) conjectures about their desire to eliminate the competition early and a few other ideas, but rejects all them due to various technical arguments. In the end he’s stuck with the idea that the aliens are just kind of jerks and just don’t like humans all that much.

The end.

Unfortunately, after fleshing out several ideas for this setting via e-mail with a few guys from one of the World of Darkness forums (Bryan Conlon, Gabe Carlson, and “Wolf”), the computer on which I stored all our correspondence had pretty much every one of it’s I/O devices break in some way. As a result the relevant information languished for years on the machine’s inaccessable hard drive.

However, this past Christmas season, while rummaging through Circuit City trying to figure out what to spend a gift certificate on, I stumbled across a kit to convert old hard disks for use as external drives. Now that I have access to this stuff again I’ll probably be sticking at least some of it on the web in the near future.

Dead On Arrival is the only actual story I can remember writing for the setting, and consequently also the only “stand alone” piece of writing that my brief perusal could dig up. So here it is.

Note: This one’s going out to the folks on the Dragonstar mailing list in the hopes that it’ll contribute to the currently ongoing discussion of vampires… in… space…

Keep on keepin’ the faith over there guys.

Three days out from Anhydrous Space Dox, salvage tug Starez IV was finally reaching it’s destination, an unusually shaped metalic object recently spotted drifting into the outer fringes of the Anhydrous star system. During closer approach additional scans showed the object to be an old-time cold-sleep colony freighter with about 4000 passangers/cargo units. At the speed it was going it must have taken near on seven centuries to get to this star system.

Well, unfortunately for those would-be colonists someone in the Terran Concordant had invented the distortion drive a couple hundred years after they set out and the system they hoped to settle was now the property of the Pentonics Conglomerate. Probably the Concordant would eventually settle them on one of the current terraform projects. In the mean time those recovering the ship would get a little money from their rescue/salvage efforts.

Starez maneuvered closer to the unweildy bulk of the cold-sleeper. A quick perusal of historical archives suggested no threat of plague aboard so contact and salvage would not be a problem. The Starez fired a couple careful maneuveres to match velocity and position it’s self close to the sleeper’s center of mass, then with a final gentle pulse of the drives (though “gentle” is somewhat relative when dealing with a fusion drive), nudged up against the sleeper.

Concordant law forbade performing salvage on any vessel until that vessel has been towed to the nearest port, inspection of the ship to be salvaged, proper claims filed, sent back New Concord, digitally verrified, fees processed, etc. In practice this is almost never the actual sequence of events.

It took only a few seconds for the Starez’ computer to patch into the primative number cruncher that ran the cold-sleeper, preliminary results indicated cryo-malfunction resulting in 99.95% of passangers dead. In other words, open locker for looting. Not an hour had passed before three spacers from the Starez plugged into suits and blew a lock see what was what aboard the old body-bag. Reports would still have to be filed, but no one would notice the absence of if a few choice items that weren’t rivoted into place.

…

It had been ages since they had awoken from torpor. There had been five of them to begin with. Rhea, Nick, Vesh, Bill, and Lord Karth.

Lord Karth was their sire of course. A rogue prince of the Bruja, when the Bruja clan still held that name. A genius when it came to the programming and manipulating the primative A.I.s of the time, but violent and unpredictable none the less.

The more floral phrase “Starry Masque” had replaced the old term “Masquerade” in vampiric parlance soon after the first clan-lord finally got the cajones to venture out into the solar system along with the rest of humanity. But the Masque it’s self had remained essentially the same: a code of laws intended to shield the bulk of humanity from true understanding of the fact that blood-drinking undead predators walked among them. Karth had a particularly blatant habit of violating the Masque that would’ve earned him decapitation on pretty much any kindred-inhabited polity inside the orbit of Neptune had he been caught. Passage aboard the sleeper had been an apparently quite successful last-ditch effort to put himself beyond the vengance of several of the more tenacious clan Elders.

Rhea was, in title, his consort. And, though the walking dead have little need of partners in fleshy matters, Karth had had strong attachments to his raven haired mate in life. In death these attachments had merely altered their focus rather than diminishing. Despiter her frail appearance, she had a potency almost to match his own in combat, and in subtrifuge there were a several areas in which she might have gained some advantage over him.

Nick, Vesh, and Bill were only henchmen, Nick the best among them.

The necessity had arrived early on, only 50 years into the journey, for Karth to destroy Bill. Bill had let himself enter blood-lust and in the process had torn apart a ridiculous 631 passangers, thereby dangerously reducing their food supply.

Vesh was also absent from their company. His body now drifted somewhere between the stars apart from the ship. He had been the first to attempt travel between sealed sections of the ship. Lacking a servicable space-suit after the incident with Bill, Vesh had cycled slowly through the airlock to prevent the damage that sudden decompression would bring. Unfortunately, after being outside for only a minute or so half his vitae had boiled through his skin from the drop in pressure and the remaining half had frozen along with the rest of his body. Somewhere out there his immobile, cryogenically preserved flesh still drifted, unless a micro-meteorite had already shattered it as they entered the system.

Soon after Vesh met his fate, Lord Karth broke open the hydraulic fluid feed to a low pressure actuator and mixed it’s contents with the blood of his meal. It may have defiled the taste of the precious liquid irreperably, but the results were satisfactory as his joints stayed limber in the vacuum beyond. In the days that followed Rhea discovered a moderately less offensive substitute in the cryo-lubricant for the sleep-capsules. Ultimately though the taste mattered little since only one dose of any sort of anti-freeze ever proved necessary.

Between the stars they learned several valuable lessons, not the least of which was how tenuously the ties to old Earth were streached at such a distance. When colonies had gone up around Jupiter and on the Martian surface the kindred there had found their loss of strength and urge to feed came in synch with the respective Jovian and Martian day/night cycles, and noticed their injury from daylight grown less severe from the weaker reach of Sol’s wrath. But out here beyond the solar system there were no planets, no great yellow eye of vengance, and the daily loss of blood borne vitality dwindled to only a trickle. In these dark reaches an entire year might pass before there was any noticable loss… unless, of course, one called upon some mystical discipline or other.

Out here the sun faded to become just one among billions of other angry points of light, their strength becomming impotent at such a great distance, as they strove to cleanse from the universe unclean things like the children of Caine. But during their time in the dark sea between, these few of Caine’s children had heard a call of other stars. Stars which through their radiance of orange, yellow, white, and blue shown to the carefully trained inner eye with an inviting red. Oh, yes, over the years they had heard these other stars whispering to them, beckoning them forward.

Unfortunately, all were much farther afield than their 4000 meals would take them, at least if they still desired some leftover kine to graze and pasture at the journey’s end. And as a result they were forced to settle for their programmed destination.

But the call of the distant stars and the eternal searching for the world of their destination made their senses sharp. Keen enough to see the tiny specks of planets across the distnace of lightyears, enough to smell the scant ions burning off the surrounding stars corona, enough to feel the etherial buffet of the stellar winds upon their hydraulic-fluid colored flesh.

Eventually their destination grew close, though still indistinguishable in magnitude from the surrounding stars. Passive sensors picked up radio transmissions from their goal, Earth-style radio transmissions (though, of course they had never heard any other kind). The transmissions were not directed at them, at least not at first. But the information they revealed was the same: Something had happened. Somehow others had arrived before them.

They were still two years distant from their destination when Karth began to prepare.

…

This would be Technician Gomez first opportunity to loot a salvage ship. Wrecks didn’t wander into Anhydrous every day, maybe only a couple times in a lifetime. There’d probably be something on this derelict he could turn over to a collector for some decent cred.

His suit thrust ports glowed from a small box near his lower back. He drifted, seemingly in slow motion, between the other two “salvage” personnell as they approached the ghost ship. Something caught the Gomez eye, some movement near the third colonist pod from the drive.

The optics of his visor automatically zoomed in on the area …to see three figures crouched on the hull below (Below? Perspective can be tricky in space.) staring back at him.

His first shock was to see that there were actually inhabitants still active aboard the airless vessel. Only a moment later as the three strange figures pushed off the hull, still many yards away, did he realize that they were covered only in the barest threads of clothing and, apart from the tools they carried, virtually naked.

Each remained connected to the sleeper-ship via a thin tether attached to an ankle. One of them was a woman with pale bluish skin, her dark hair shifting in sympathetic motion around her head. Another, a male, had the same coloration, though the third had a light orangish cast to him. Gomez found something about the combination of colors oddly familiar, what was it they reminded him of?

It occurred to him that at their rate they were drifting toward him they must be moving at unbelievable speed considering their only acceleration impulse was from pushing the hull. Were they some genetically engineered “branch” people? He’d heard of humans altered for weird atmospheres, but none for a total vacu …

Gomez never finished the thought, he barely had time to react when the female reached him, grabbed his suit by the faceplate and ripped both helment and head off with one taloned hand. Near her Karth had already discovered how to operate the attitude thrusters of the corpse bearing suit in his grasp. Nick gave a wry smile as he scooped a ice-coated globule of red liquid from the vacuum nearby.

Their first victory had come easy, but a greater task was still at hand. This meal had apparently come from somewhere relatively close by. It was some comfort that the pre-existing presence of kine in this star system would make it unnecessary to ration themselves for years while trying to build up a colony. But gaining power in this new arena with it’s unknown technology and political terrain would likely be a challenge in and of it’s self.

Fortunately it was the sort of challenge Karth most enjoyed.

Thematically, each poem centers on the flying numbers 1, 2 and 3. Rather convolutedly, the poems were also connected to a project (which is currently shelved) called PJ the Robot (and who in many regards still lives on). Even more convolutedly, PJ was an acronym, standing for “propaganda jox”, both a call to arms against the current state of world affairs and an allusion to a bygone time when the only enemies on the face of the Earth were Russia and the USA. The final thing that should be noted is that both“propaganda jox” and PJ owe a lot to Stuart Gordon’s film, Robot Jox (1990).

Crash and Burn and Flying Numbers.

Click here to download a PDF version of Flying Numbers.

“Try not to get any of that on the floor, Berny — they just waxed in here!” I called out as I clacked away on the keyboard.

“Fu— blauguguguguguguugugug!” replied Bernheim.

I laughed. My laughter was quickly quelled though. We were in big trouble and by my calculations had 1 hour and 17 minutes to stop a black hole from consuming all of Chicago. In another twenty-four hours, it would be the world.

Doctor Wheat, Belinda, was racing through the printouts. Sure, she had a dumb last name, but what a rack. Besides being a knockout, she was great in bed. I had designs to marry her one day, but for now I was content to sleep with her.

Beside Belinda was Jerry Norman. Jerry was a top-notch scientist, but to be blunt, my brain was more powerful than his. Of course, this accounted for why Belinda slept in my bed and not his. Besides not possessing the mind I did, Jerry was a nervous wreck. Normally he was all ulcers and covered in sweat. Right now, however, he looked like the Amazon during rain season, and I figured it was moments before his stomach acid erupted from his naval like a geyser.

“Belinda,” I asked, “have you turned anything up in the printouts yet?”

Belinda shook her head no. “No, I haven’t.” Even in a time of crisis she looked hot.

“Goddammit, none of this makes sense!” screamed Jerry.

“Jerry, dude, man, comrade — take a chill pill,” I said.

Jerry glared at me. “How the hell can I be calm in a time like this?!?! We’re all gonna die ’cause a black hole has just opened up in Chicago and no one knows how to stop it! No one even knows how it happened! It’s impossible!”

“According to what we know,” I said.

Jerry looked at me, and so did Belinda. Even Bernheim stopped vomiting for a brief second.

“What???” asked Jerry flabbergasted.

“I said, according to what we know. We need to think outside of the box Jerry. We need to think like a black hole.”

Jerry nodded his head. “Okay… but how?”

“We need a fourth science to defeat the black hole,” I said. “Chemistry, physics and geology can’t explain what is happening. In fact, if you combined all those sciences, you still couldn’t explain things. So we need a new science, a fourth science. Then we can fight the black hole. We need blackholeology.”

“I thought… there were –”

I finished Jerry’s sentence. “More sciences? Like Biology?”

“Yeah…,” said Jerry.

“The black hole just ate biology, Jerry. You’ve gotta quit thinking like a scientist and start thinking like a black hole.”

Bernheim started vomiting again and I winked at Belinda.

The stranger strides forward amid the jubilant throng, a thing apart from these others gathered here. Every line of it bespeaks purpose, effort, determination. It seems not so much to walk forward as to struggle, as if against beating rain and unseen gale or as one heavily burdened.

It’s entrance has not gone unheeded. The keenest ears perked up to sample the notes of it’s knock before they fell and the sharpest eyes glimpsed it’s shape before the first leathern boot crossed the threshold. But those early insights are long passed and even the eyes of the least attentive seek to ken the being’s nature.

“What think thou: Pooka of some barbarous realm? The antlers…”

“Nay, nay. He’s no Pooka surely. Stag be herbivore and I spot a carnassial pair in them gums.”

But it is a he-thing at least. The beard seems to make this much obvious.

Still, though much can be kenned and the court lore keepers have already guessed it’s ilk there remains a sense of distance to the thing. His shape seems solid enough (almost too solid) but the details ripple and waver as if seen through a fast moving stream where currents of hot and cold mix. The effect is strangely disorienting leaving one with the fleeting but uncomfortable impression that this thing is the truly real thing and all else but a moment’s fancy by comparison.

The ripples it leaves, the wake of it’s passage as it labors forward, spread outward through the crowd and with them spreads change. And this change is familiar. You know this feeling. You’ve felt it before a thousand times in a dozen lives. It’s the Firchlis, Glamour’s warm breath on the frosted glass of Dreaming. Strange though to feel it in a Freehold. Out of place.

And for a moment it’s suddenly clear why the Fir-Bholg (for that is what he is) struggles forward with such effort. It’s winter. In your revels and joy amidst each others company you nearly forgot this is an outdoor fete. What with the bonfire glowing so, you lost track of how deeply the snow had begun to drift and how gusty the wind had become.

He’s clearer now: clad all in hide and leather (old, brown and worn). At his back a sack of the same. Slung over one shoulder the strap of an old tinker’s pig, and at his hip some verdigrised piece of bronze-work: half sword, half cleaver, half machete, apparently a tool as much as weapon.

His body seemed massive, but another trick of the mind perhaps? It’s clearly a more spare and weathered frame bent there against the snow. The face, mature perhaps but not yet weathered with the burden of later years, looks pensive. There’s a fire in the eyes bespeaking dreams yet to be played out, but the furrowing of the brow suggests concerns, second guessings, the hopes that things might turn out differently than they have.

Though still approaching the Fir-Bholg seems half a field away now, crunching through packed snow with focused tread. The snow remains thick, deep, crisp and truly frozen, but something in the tramp of those worn boots conjures their fall instead amid the rot of leaf mould. A compost from whence growing shoots and creeping things struggle forth.

These changes play out before you. But you look on impervious in your mein and voile, secure in the intensity of your own dream.

“But wait… this is a Freehold,” recalls the Freehold. It’s glamours too are strong and backed up by Balefire, not bonfire. It remembers it’s hearth, it’s sconces, rafters, roof, graceful windows, tapestries and assorted decor. It’s permanence reasserts and the Firchlis’ changes fade leaving only their memories.

The visitor regains a more appropriate (and much less grandiose) proportion in the minds eye as he at last approaches the area traditionally reserved for audiences.

Bowing to one knee he begins:

“Karst, I

“Explorer, tinker, come recent from study at the Great Machine (though little I remember of ‘t anow).

“A’ ye ken Winter is comes, true.

“I ‘en about and seen: Courts a’ Formor are afoot. ‘an misfortune is such my “peeps” (as ye folk say) are divided. Some deny the courts awake. Others (fools) seek alliance wi’ that Dark. But there lies madness and I’ll none of it.

“As of old goes: Enemy mine enemy, mine friend.

“So sought ye out and would ‘ve place among yer ranks an’ alliance in the war to come (perhaps also after if it do ye.)

“I’ve not the Changeling Way about me but what Arts are mine are sufficient to provide mortal flesh if such is a requirement of this court.

“This one’s gifts, meager though, yet yours as asked.”

Thus saying he remains crouched in bow, antlers dipped low. The wait is perhaps brief but from his stillness and the set of his posture it seems he is prepared to remain thus years should it be this court’s will.

Flames flicker at the hearth and the seconds pass.

Mr. Pony 
fancy-pants
doin' the Mr. Pony 
sparkle dance
Twirls 
   and 
      Spir-els
for the squealing 
                    girls
Who love 
that stupid pony

Shoney 
Money
Noney

with 
    regal hat 
    Pony-Prance
outta sight 
fat wildcat(s) trance
and ending(s) 
stop beginning(s)
on the giraffe neck(s).

She allowed the body’s spin to rotate the massive sword in her right hand across the her faceless enemies’ field of fire so that their rounds played a rapid chime against it’s surface. It was a massive blade. A nodachi about 6 feet from tip to butt (about half of that tang) with a blade as wide as a couple meat cleavers stuck together and just the faintest, most elegant bit of curve to it’s perfectly honed edge. The thing had been crafted of solid bronze using an ancient technique which compressed the metal rendering it harder than titanium.

From the size and ultra-density of it the sword must have weighted a good 60 lbs. but Gaji wielded it in one hand as if it were a machete, using individual rounds from the “sub” (the fully automatic sub-machine gun that fired caseless ceramic bullets) held in her left hand to pick off stray fragments of shrapnel which might otherwise have torn the long matte-and-satin black kimono which rippled elegantly about this body. The only visual hint as to the sword’s true inertial mass was the way it’s center of gravity shifted in relation to the relatively small body she occupied, and even then only when in freefall, as was now the case. The sword’s coppery coloration and verdigris patina somewhat contrasted with the black-on-white visual theme she sought to attain with this body and it’s accouterments but she liked it anyway and had decided long ago to keep it.

The slugs of her attacker’s weapons skidded harmlessly across the ancient blade’s surface by the hundreds, their progress irrevokably altered by the indestructible metal. The thing remained unharmed but ideograms, older than the universe it’s self, once etched invisibly into it’s surface now sprang to life with a hungry glow like light being shone through the flowing stream of a viscous red liquid. It drank in their violence and obsequiously begged that it might return the favor.

As she drifted across the room there was a split second pause in the gunfire as one of the body’s feet touched the ground and began to push off sending her on another fast, low, wuxia–choreographed arc through the air toward the attackers. Ever having the right word for the moment Gaji took advantage of this brief respite from the guns cacophonous cough to toss a careless bit of repartee in the direction she was headed:

“Sorry boys,” intoned her sultry voice with a tauntingly ironic lilt, “I seem to have left my katana at home tonight. I hope this old thing will do.”

The ceaseless explosion of automatic gunfire again filled the room.

A Scandal in Paris (1946) is a film directed by Douglas Sirk.

People
"effected"
with what they know.

Unsurprisingly.

Wasted
and
mundane -
It is
card
repeated
for
Joan Baez
some
70's cult.

In
the 
greenhouse galaxy
dreams
of 
Walden
die.

Silent Running (1972) is a film directed by Douglas Trumbull.

Every time I
make a mess,
I find
an
angel.

When I was 
a little kid
I wanted to grow up
to be a donut shop.

I thought being
a donut shop
would be good career
for me.  
I liked the color red,
flashing lights,
ladders
and Dalmatians.

Today 
I may work
in IT,
but when people
ask me what I do,
I tell them
I'm a donut shop.

Idea.

The 
Future
isn't
tomorrow.

It's
today.

Super-Technology.
Super-Code.
Super-Alphabets.

Think.

BIG.

How deep
does love run?

Daughters
taxi
at airports
for
daddies.

I wonder,
about
French cool
and photo-chopped
shoots.

I audit
not to attend them.

Though...
maybe I should find out.

Tears
on shoulders down
motherless fathers
for the sons whose 
dad's were
bagged.

Ôdishon (1999) is a film directed by Takashi Miike.

Tonight 
I was restless.
So I ran
blind
like a bad
Rober Frost poem
from those
pesky blind
satanic 
Templars
in the 
eurotrash 
graveyard.

La Noche del terror ciego (1971), is a flim by Amando de Ossorio.

I watched Serial Slayer 
AKA Claustrophobia 
twice.

The first time, 
I watched it.
The second,
I listened.

To someone
else, 
somewhere 
else,
it
had
another.

For me -
it's only a 
down turned smile
and
people I knew.

Serial Slayer (2003) is a film directed by Mark Tapio Kines.

Pawns
roll
oak
in
rage
for
the
war
of
nuclear-moon
at
time's
end.

Death is another oil change
hatched in my day's way.
Stupid death and stupid dying.
Who made it anyway?

The old hen pecking God?
Well, I'll cock and sock his nose,
make him roost the golden egg
chooking as I hearsing go.

For from the shells I sell to L-OC-als
I'll build feather couping waves,
Buy up Death's garage and scythe,
chicken farming from the grave.

The urlanders speak
of man turned brill
who goes by the name
of Walt MaGill.

They say he's mad,
that he spits salt dement,
all night blue
to waterclock chant.

And that if you go 
by the babbling cave
and listen you'll hear
him foaming depraved.

But don't listen too close
the urlanders warn,
for the bulbous song
can turn you sideways.

Click here for more.

Secret City

Secret City
ufos 
and 
secret 
cities 
commander mark 
knows how to get there 
a land where 
everybody paints little happy trees 
and is fed, housed and entertained 
like logan's run 
no bills 
just pills 
under socialist reforms 
is that the life for me?

April 2002

Click on Commander Mark to go to the Secret City.

When
Zango Bango
went
no one could 
remember
his zany name
even though
he was the undisputed
authority on eating a mango,
had written four books and
twenty articles
on how to Tango,
traveled extensively
from Tibet to Durango,
won a gilded trophey
for crushing the mighty
Yen Chango,
and even
written philosophy
like, "Why fight
the void but to fight it 
and grow."
Oh no.
No one recalled that.
They only thing
they remembered
(rather consistently)
was that he was
a very nice 
smelling 
fellow.

I'm afraid
no one
loves a
Ploplit 
plopped
on a stump
in goo,
because
many things
in life
lack reason,
and are
very, very 
cruel.

Answers
are electrical
for the
sewer mage,
down deep 
beneath
the grey 
and cleaning
waves.

These futures
are forgotten,
plodding
in dim swim,
coiling
by the brick,
drips forever
unwritten.

Till ooze
becomes
eccentric,
to question,
buzz 
and 
speak,
turning all it
touches to the
grey scenarios
he seeks.

This poem was inspired by Dragon’s idea of the Sewer Mage.

Click here to see an earlier version of the Sewer Mage

Seriously 
guys?
Why'd 
I 
have
to 
get 
the
purple 
suit?
If
there's
a 
race 
of
Commie
Moonderthals
up 
here,
I'm 
a 
big
walking
grape 
target.

I went to 
the gas station
and found
gas prices were 
sky high.
So I went to the pet shop
to spend my gas money
on a hamster,
but hamsters cost more
than gas,
no lie!
But the pet lady 
told me that 
mamsters were free,
and I thought,
hey - lucky me - 
now I can spend my 
two "O" five
on ice cream.
I got the
mamster 
and the
little sucker
mangled my hand!
And I screamed
"This mamster
is as mean
as gasoline!"
With that
the mamster
chomped,
and I howled again,
"I'm gonna stick
this mamster in my 
gas tank!"
And the pet lady said,
"Sorry sir.  
You can't do that."
I asked why not,
and the pet lady said,
"Why sir,
don't you know?
Gas goes there."

Glamourarra Glitterarra
came to disco go-go
down from NY 
all the way to San Diego.

She said she was on
vacation,
in flash of lash
and boot a' move,
which caught the glint
of golfin' CEO's
dribbling lobster
on their 
money fat suits.

Those CEOs purred
"Glamourarra Glitterarra
on TV 
would be some
rabbit hat trick..."
all the while
feeling their wallets
grow ghoul green thick. 

But what those CEOs
did not know,
was that 
Glamourarra Glitterarra
worked in TV also,
and was broadcasting
back feeds 
from Orion's Belt
to M83 -
with those
sloshing CEOs
as the fool-stars
of her very own
#1 pan-galactic show.

Headless 
dressed
The 
Horseman
is 
here.

Washed 
in 
tons
of 
blind 
ride
fear.

A 
haunting 
made
from 
a 
suit 
of 
snakes.

While 
I's 
are 
eyeless,
in 
this 
our 
wake.

The
reason
why
Squorty
Tails,
the 
Delmarva
Fox 
Squirrel,
didn't
have
a
girl-squirrel-friend
wasn't
because
he 
didn't
know
how
to
charm
em',
but 
because 
he
was
endangered.

Click here to read more about the Delmarva Fox Squirrel.

Werewolves 
just don't bother me,
only traveling Weretos.
Never going home
when they know
they really should soon.
Oh I wish they'd go and
pester, Josie, Jill or Jeff
Check into the zoo at Salisbury
take up residence 
with that inconspicuous sloth.
Oh those, Weretos, Weretos,
where for out yous?
Making a ruckus at 
continental breakfast,
(that's where)
never bidding fond ados.
Always doing annoying things
like wearing out my new shoes
But really,
there's no sense in arguing
with an
"I Can't Wait!"
Cause a Wereto only knows 
one point of view...  
So pack an extra knapsack.
Hope the Stewardess doesn't ask.
The Wereto is going,
no matter when,
no matter how,
no matter what address.

For me, the first of these aforementioned film experiences actually occurred at Berks, watching Pier Paolo Pasolini’s, Salò o le 120 giornate di Sodoma (1976). If I watched Salò today, I’m not sure how much it would shock me. This isn’t to say that its depictions of burning penises and women sitting in vats of poop isn’t horrific. Rather, it is that I now have more of a context to couch the film within and realize that Salò was aimed, in part, to shock with its portrayal of fascist Italy. As such, today, the films that leave me unsettled now are of an entirely different breed like Terry Zwigoff’s Crumb (1994), a documentary about the life and times of comic artist Robert Crumb (Grue will back me up on this one). And then there was last night’s film, Jim Van Bebber’s Deadbeat at Dawn (1988).

Originally I hoped to watch the film with my friend Brian (Dick), because I know he has a penchant for the Nintendo game River City Ransom, a video game (as far I can tell) about thugs beating other thugs up. When I initially read about Deadbeat at Dawn, I thought it sounded like a celluloid version of River City Ransom. And on its surface, that’s essentially what Deadbeat at Dawn is. The story of Deadbeat at Dawn is pretty straight down the line as thug fantasies go, reading something like: Thug goes out and fights other thugs; thug goes home to girlfriend who convinces him to give up thug-life; thug does so, but then other really bad-thugs who are pissed off at said thug kill thug’s girlfriend and in a rather roundabout way thug enacts his revenge on bad-thugs. In addition to a cartoon plot (or video game plot), there were ninja stars, nun-chucks and plenty of shaggy Chuck Norris antics to boot.

So what on Earth made Deadbeat at Dawn one of my most frightening film experiences in recent memory? I can hear you saying, “The film sounds fucking retarded.” Well, I’ll tell you — Jim Van Bebber, the film’s director, writer, star and auteur, did.

Let me explain. Back in my heady days of playing Dungeons and Dragons, somewhere in my head I drew a line between the kids whom I’d fight imaginary monsters with and the kids whom I wouldn’t. Funnily enough, the division had nothing to do with the kid being a dickhead. Due to the very nature of the game, you were inevitably going to play with dickheads, because you needed them to fill out the table. These weren’t the kids I shied away from. Dickheads were welcome, and today some of these same dickheads are my best friends.

Scary kids, on the other hand — I steered clear of. Sometimes they wound up at one of the tables I sat, but I either never invited them back or met them on neutral territory after I got a sense of their agendas. Usually these kids had penchants for black, camouflage and trench coats, blades, Satan and scary music. My mother never told me that I should avoid these kids like the plague, I did it instinctively.

Perhaps it was these instincts that I honed early on that gave me cause to suspect that these wayward children were lost souls, and it had nothing at all to do with Dungeons and Dragons, but something else entirely, something much, much darker. For instance, I watched Mazes and Monsters (1982), directed by Steven Hilliard Stern, and managed only to find absurdity in Tom Hanks’ portrayal of a gamer gone mad. While the events that inspired the film were no laughing matter, the depiction of Dungeons and Dragons as a gateway to the dark-lord himself was farcical. Was my laughter misbegotten? Something, after all, made the scary kids tick and want to do things like venture into the sewers in search of the black demon goat god. Even though my idea of D&D was listening to the Swedish jazz of Bo Hansson and drinking generic cola, maybe I, too, was just a dice roll away from a subterranean adventure of blood and madness.

So, during my senior year of high school, I set out on an adventure of my own of sorts, when I decided I would either dispel the myth that Dungeons and Dragons was the root of all evil or confirm that it was indeed a skintling portal to hell. To do this, I chose to write senior term paper on the subject.

Research began, along with my many hours of sitting in the Wicomico County Library. The brunt of my paper focused on an a group of kids who had been involved in a series of killings that had been linked to their fascination with the game. The arguments tended to be put forth by conservative watch-dog and/or religious groups. The more I read, the angrier I got, until eventually I was pounding my fists, thinking, “These fools! This isn’t even bad sensationalistic journalism, this is just propaganda mumbo-jumbo!”

Something happened though, and suddenly I forgot all about my “right fight” when I was distracted by none other than a girl. I began to refer to her as the “Library Girl” (she was the start in a long line of many), as she was in the library most of the evenings I was there, obviously working on her term paper, too. She wasn’t from my school, as I’d never seen her before. My friend Chris, who came with me some nights to work on his paper also, hypothesized she was from Bennett, a local rival high school. Soon my notecards became filled with odes and lyrics immortalizing the Library Girl. She’d never hear the songs though — because not only was I too scared to talk to her, I couldn’t play guitar. Accordingly, I did the next best thing, and began drawing with Chris a series of caricatures of none other than guitar legend Kurt Cobain. Beneath Kurt we rather ingeniously put captions with Nirvanian messages in them like: “Hey, way” and “Let me eat your cancer.” “God,” I thought secretly in my head, “if the Library Girl could just see one of these pictures, she’d think I was the cleverest man alive”.

Though I never talked to the girl, I wound up having a great time writing my term paper and inadvertently discovering the answer to the question it posed about Dungeons and Dragons. Things like grisly death just weren’t for me. I wanted to laugh and have a good time, whether I was dreaming of Library Girls, drawing pictures of Kurt or playing Dungeons and Dragons. My final conclusion was: Dungeons and Dragons didn’t kill, fucked up people did. Though I didn’t write that as my clincher sentence in the term paper, in retrospect, I know now that I should have.

So what does all of this retrospection have to do with Deadbeat at Dawn? Deadbeat at Dawn was one of those films that gave me the sense that most of the actors in it had played Dungeons and Dragons at one time or another. However, they were the same kids who were on the other side of the line.

While the violence of Deadbeat at Dawn is pure drive-in-exploitation and adolescent fantasy of the highest calibre, the true brutality of film lies in the reality constantly boiling underneath the film’s images. No matter how many tomato-sized jugulars are ripped out of people’s throats, there is something ten times scarier about the raw conviction and intensity that virtually all the film’s actors bring to their performances. This gives the viewer, who from the first minute of the film knows it is at best a B-Movie, cause to wonder just where the acting ends and the actors’ realities begin. It becomes quickly apparent Deadbeat at Dawn isn’t a Chuck Norris outing like Delta Force (1986), directed by Menahem Golan, but instead a film made by people who desperately wish Delta Force was for real.

This isn’t to suggest that Deadbeat at Dawn is the work of a madman, because it isn’t. Rather, Deadbeat at Dawn, is truly the work of an artist who not only seems to be fully aware of the pitfalls of his chosen genre, but is constantly willing to subvert, challenge and complicate the representation of his vision at almost every turn.

Along with Deadbeat at Dawn’s somewhat too intense performances, this is evident on an artistic level in the film’s portrayal of its central protagonist, Goose, played by Van Bebber. While Goose is highly romanticized, from his ninjitsu-absurdity to his Rambo physique, his character is again and again placed in an undignified light, a light which subverts his character’s more romanticized traits. At one point in the film, Goose hides out with his father, a crackpot and drug addict who shoots heroine in his toes. When Goose’s father tries to kill Goose for junk money, Goose punches him and proceeds to give him the money telling him to kill himself if he wants. The disdain and loathing for his father is apparent.

Yet Goose’s loathing is shown to be hypercritical, as he himself is not only a drug addict, but also a drug dealer. Shortly after Goose’s girlfriend is killed, Goose goes on a drug binge, winding up stupefied and fumbling with a gun. A nearby bum, afraid that Goose is going to use the gun on him, asks Goose what he plans on doing with the gun. Goose answers he’s going to commit suicide. The bum laughs that’s cool, as if to say even he, a cowardly hobo, is not that stupid. It isn’t Goose’s own good sense that prevents his suicide in the end, but one of his fellow X-gang members.

Even Goose’s final revenge on the gang who killed his girlfriend isn’t accomplished because of a set of noble heroics. Rather, it is comes about merely because Goose attempts to preserve his own life amidst a gang coup. It’s only after the gang start killing other members that Goose realizes he’s next and, in attempt to preserve his own life, is able to exact his revenge on the gang members who killed his girlfriend. In a way, Goose finally becomes a Chuck Norris of sorts with the conclusion of the film, but his transformation is one that is fractured and distorted, much like the fractured kaleidoscopic transitions between the various scenes in the film.

In this regard, Deadbeat at Dawn finds a kindred cousin in the writers of the American Naturalist tradition of the early 1900’s like Frank Norris and Theodore Dreiser. Whereas Dreiser and Norris had often utilized melodrama and sensationalism to reveal what they felt to be the reality inherent in the worlds they wrote about, Deadbeat at Dawn similarly uses its comic book violence as vehicle to reveal a very real world of the streets.

The DVD itself is chock full of great extras, such as a commentary from Van Bebber and the film’s producer, Mike King. It also contains the surprisingly good short film, My Sweet Satan (1994) also directed, written and enacted by Van Bebber. Whereas Deadbeat at Dawn’s pulpiness may deter some from seeing Van Bebber’s talent, My Sweet Satan, makes it quite clear. While the story of the film is very straightforward like Deadbeat at Dawn, Van Bebber is virtually unrecognizable as Ricky Kasslin. Without raving more about the merits of this DVD and the films on it, I should end it by saying that if any of this review has piqued your interest at all, then you should do yourself a favor and check out Deadbeat at Dawn as soon as possible.

Ultimately, like those kids on the other side of the line from my Dungeons and Dragons days, I wouldn’t want to hang out with anybody responsible for or who acted in Deadbeat at Dawn. However, this doesn’t mean that the film isn’t a truly stunning piece of independent cinema, because it is and very possibly a work of genius.

For Megan

The Suspension of Invention

It's called the suspension 
of invention because
there is no such
thing as the
invented!
Yes, I fear
it is a comprehension 
of total misapprehension;
a belief from an invisible
incongruous dimension,
because I ask, 
how can it be made,
if it fails to exist?
Inventions are 
the invented intentions 
of extremely demented
head-ghouls who work
by ghostly-dark.
And head-ghouls are
notoriously uncemented
and mixed-up!
No, no, no, trust me, 
they all are...
That's why they hang in
graveyards 
digging other 
people's thoughts.
Yes, I know what 
I'm talking about!
Flights of fancy 
simply can't exist, 
they never-ever will!
That's ipso facto final!
So what are we 
doing here you ask?
Why we're inventing truth!
You're not even listening...
Now why on Earth did you
just give me a kiss?

The Illusion of Flight

You just
don't know 
what you're
talking about...
Saying I 
can't fly...
Saying I 
might as well 
give up 
dreams of wide 
Big Sky...
Should I 
curl up 
and metaphorically die?
...
Ho-Hum.
...
Well first off, 
Big Sky is a place
(IN YOUR FACE!).
And for 
your information,
it's a 
town down 
in Montana!
And if a sky 
can be place,
Then I'll
elude your illusion
with my spoked
wheels flying
in a bicycle race!

Grumblings are always grumbling,
about this and that.
Go ask a Grumbling to take out the garbage,
he'll retort, 
"What, and waste my time?
I ain't doin' no rubbish like trash!"
Or tell him to trim the hedge, 
and he'll growl very low,
"Leave me alone, Jack, I'm bushed 
and am staying planted right here 
so long as I can't figure out
what whack smack you are barking about."
Try to get a Grumbling to feed the fish,
he'll reply composed and reposed,
"I just can't do it, Trish, 
for I fear the only fish I'm hooked on
come off punch-lines and onto my dinner dish."
Though, the true problem comes
when the Grumblings are more than one.
Whereas 'a' Grumbling can be humbled into mumbles
with 'a' strategically placed TV 
(which he'll watch indefinitely),
if a number of Grumblings start 
stumbling though doors, jumbling out windows 
and falling in a bumble of tumbles 
down the crumbling chimneys narrow,
that grumbling will roar into a rumbling crescendo
that even the mayor can't fix,
because by then he'll be grumbling, too,
with little, if any, clue of how to save
a neighborhood that has gone to 
the Grumbling zoo.

Welcome to Pervertimore,
knock on my door naughty minx
and I'll beckon ye' in
to spank your fanny,
feed you Calvert's special crab cakes
and the papaya nectar
of our love lingering on the thorny worm wood -
Ca-ca-ca!  I cry at your caboose,
nooked and sploondid,
from my depraved raven roost
where I sleep nevermore
one eyed in leery lust.

Crowspun,
has gone 
to fix 
the wheeler,
so he's taken a
spin right over 
to the dealer's
for an inspection
leaving
Scarehat alone
in the swamp
drinking bog-water again
doing the stomp
trying to remember
why he wears a hat
January through December.

Mr. 
& 
Mrs.
Amoeba
quite the pair,
off to the
neighbors,
theatre,
Grand Canyon,
and everywhere.

Over the roads,
Through all 
the burbs 
Wayup 
  &
Wiseside
Knifejacking
      the 
         curbs.

"Oooo!" Mrs. says,
"Those neighbors, a fine pair!"
"Those players," Mr. goes,
"Made you feel right there!"
"And the canyon so deep!"
They cried tossing pebbles
                     down 
                     in,
Till a serious young man chided,
"You one-celled fools, does it all lead anywhere?"
To which they both laughed and replied,
"Perhaps, but honestly who cares!"

Hey people,
I'm the Wizard
of Quiz
I know all the answers
to make you 
flip your lids.
Smoking toadstools
or drinking dry limes
I'm the Quizard 
who quizes
your rotting minds.
Non-stop,
my questions
for fetid thought
under the bazar,
Ooo!  Look!
What's that trinket
on the blanket
to be bought? 
But please
take care
and do beware:
for this is 
just one fun 
question of mine,
among 10 zillion 
for the brain's
fizz cauldron.

Squidicus Leviticus
stayed up
too late 
looking at the clock
one eyed
when rather lurid
he decided
the clock
was a plate.

Then he slept,
and while he did,
all the roman 
numerals loosened
and trickled
Leviticus past,
I, III, V,
just about that fast.

Till from 
his slumber
he jarred
eyed wide
to stop his watch
in a tear cried, 
"This plate is Death,
for goodness sakes!"

I M
L RON
from 
ancient
stars,
now may
I borrow
your
IRON
for my
new blue shirt,
I am
serious
not
IRON IC (SIC)
for
I 
dream
from
B-YOND
B-WARE
what
the seer
sees
in
false
light,
for
the
Solar 
System
is 
Solar
Powered.

Morty
the
Mortician
was a kind
of a beautician
who
slurred
his words
cause he needed of
a SpamSieve,
not a liver,
to filter the
whiskey rye,
and when grandfather
died,
my mother
was
absolutely
mortified
when old Morty said,
“No one gives
two hoots
about stuff like nutrition
when you go to the
palace in the sky”.

U nless you like flowers

N ot that I’m prejudiced

T hat would be presumptuous

F uck Croatia anyways

A nd all their Croatian ways

R ed Bull and Red Politics

T hat’s all those fuckers got

Brings

Hate

and

Hate

Brings

Love

Go Figure!

(Author Unknown) [Taken from toilet stall wall made of steel in the Learning Resource Center (LRC) at CC on November 03, 2004]